Skip to main content

Massive citizen science sampling and integrated taxonomic approach unravel Danish cryptogam-dwelling tardigrade fauna

Abstract

Tardigrade diversity and distribution are enigmatic in most parts of the globe, and only some European countries can boast of a relatively well-studied water bear fauna. However, even these suffer from the lack of genetic data, which would substantiate faunistic data and make biogeographic comparisons easier. Denmark has never been intensively and systematically researched in this regard, thus a citizen science sampling of cryptogams (mosses, liverworts, and lichens) was launched in spring 2023, aiming at a comprehensive biodiversity survey across this insular country. Nearly 700 samples were selected out of 8.000 sent to NHMD, based on the quality of samples, representativeness of various regions of Denmark, and the type of substrate to allow unravelling of potential ecological associations between tardigrades and cryptogams. Importantly, a large fraction of morphological identifications was backed up by DNA barcode data based on ITS-2 (1001 sequences), and in some cases also on COI (93 sequences) and ITS-1 (22 sequences) molecular markers, which are recognised DNA fragments used in species delimitation. We quadruple the number of known Danish limno-terrestrial tardigrade species (55 spp. reported in this paper vs. 14 spp. reported in literature so far, most of which were contentious due to the insufficient knowledge on tardigrade taxonomy), demonstrating the power of integrative taxonomy. No fewer than nine spp. are new to science. This is the first case where tardigrade fauna of an entire country is examined both from morphological and DNA barcoding data perspective.

Introduction

Out of the seven deficiencies that torment biologists exploring biodiversity [1], the most primeval are the lack of knowledge on taxonomy (Linnean shortfall) and biogeography of organisms (Wallacean shortfall). While the first is currently being addressed with comprehensive sampling and phylogenomic data even for microscopic animals [2], the latter is more grave with a decreasing body size of studied organismal group [3]. Tardigrades, the closest relatives of arthropods and onychophorans [4, 5], represent meiofauna (microfauna) both in marine and terrestrial habitats. Both shortfalls are utterly timely in their case: tardigrade classification undergoes revolution thanks to the integrative approach, converging classical light microscopy, scanning electron microscopy, karyotyping, and DNA barcoding [6, 7] into reliable species hypotheses and higher rank systematics. The process of defining species distributions and biogeography of tardigrades suffer from scanty and biased sampling, but most recent studies indicate biogeographic structuring, in contrast with the previously purported prevalent cosmopolitanism [8, 9]. This translates into the need of further biodiversity surveys supported by DNA evidence, which increases objectivity, enhances comparability between various studies, and thus reduces the risk of establishing synonyms [10, 11].

The Danish tardigrade fauna has been meagrely researched, with the current species count standing at 18 spp. (four marine and 14 limno-terrestrial, see Table 1 for details). This stays in a stark contrast to the nearby Sweden ([12]: 101 spp.; a long history of research since the times of Thulin [13, 14]) and Norway ([15]: 146 spp.). Only the latest survey employed a V4 region of the 18S rRNA marker in environmental DNA metabarcoding of Danish soil samples [16] to uncover multiple eutardigrade lineages. Pust et al. [16] revealed that Danish fauna embraces 96 (!) molecular operational taxonomic units (MOTUs), which could correspond to species (however, a species delimitation based on 18S rRNA chiefly underestimates true α-diversity, so some MOTUs may represent more spp.). An important achievement of this study was the discovery of presence of virtually all (11) eutardigrade families, which could be suspected of occurring in Denmark. The same goes for several genera, which otherwise would be particularly difficult to extract from samples via traditional laboratory methods (Bertolanius, Eohypsibius, Eremobiotus, Hexapodibius, Microhypsibius, Mixibius) due to rareness. Hence, we consider the list of MOTUs provided by Pust et al. [16] to constitute a backbone for modern faunistic research on Danish tardigrades, which must be corroborated by both morphological and molecular evidence.

Table 1 List of Danish Tardigrada recorded prior to this study (synonyms excluded)

In order to thoroughly address the fauna of tardigrades dwelling in cryptogams across the country, a citizen science project Masseeksperimentet (https://masseeksperiment.dk/tidligere-eksperimenter/masseeksperiment-2023-mikroliv/, subsequently referred to as ‘Mass Experiment’) was initiated in 2023 in collaboration with the Danish National Center for Science Education, Astra. School classes throughout Denmark (Fig. 1) were involved in collection of cryptogams (bryophytes and lichens) in their respective localities during several weeks in May and early June; pupils also recorded geolocation, habitat, and substrate in the national biodiversity monitoring platform Arter (arter.dk). Samples were later delivered to NHMD and a selected fraction examined using standard laboratory pipeline for tardigrades [17]. In parallel, all cryptogams within these samples were identified by taxonomic specialists, which resulted in a complete database of tardigrades, mosses, liverworts, and lichens. Such approach, in principle, will allow for disclosing any substrate-tardigrade associations, and means that the Mass Experiment is the first mapping of tardigrades and their host cryptogams together throughout an entire country. It is anticipated that integrative taxonomic methodology will greatly facilitate ecological research on tardigrades, a rather sporadically tackled topic up to date [18].

Fig. 1
figure 1

Map depicts the density of schools involved in the Masseeksperiment’23 within all Danish municipalities (inset: Bornholm). The scale refers to the number of schools (each school delivered up to 10 samples)

Methods

Sampling and sample processing

Around 8.000 samples were collected by school pupils in various regions of Denmark (Fig. 1); cryptogams were packed into small coffee filters, completely dried, if necessary, and sent to NHMD. 676 samples were selected for tardigrade examination based on the amount (typically at least 10 g of dry tissue) and quality (without mould; leprose lichens were discarded) of material and represented the following regions: Zealand 290, Jutland (including Vendsyssel-Thy) 284, Funen 34, Bornholm 24, Amager 13, Lolland 9, Falster 9, Langeland 5, Anholt 4, Samsø 3, Møn 2. The list of all samples with collection data can be found in the Supplementary Material 1. First, all tardigrades were extracted from cryptogams (entire samples were used; the amount of dry substrate varied between 10 and 30 g) as summarised in [17]. In most cases (ca. 90%), entire sediment was poured onto a single Petri dish ( = 10 cm), but when a large amount of soil obscured extraction, it was divided into further 1–2 Petri dishes. Later, cryptogams were analysed and identified at least to genus level (but in more than 80% cases to species level) by specialists, to enable unravelling potential tardigrade-cryptogam associations. This will be addressed in a future paper, entirely devoted to ecological preferences of tardigrades regarding the cryptogam substrate.

Microscopy and imaging

Specimens for light microscopy were mounted on microscope slides in Hoyer’s medium and secured with cover slips. A brief recapitulation of the procedure can be found in [17]. Permanent slides were analysed in an Olympus BX51 compound microscope with differential interference contrast optics, and in Olympus BX53 microscope associated with a Olympus DP74 digital camera. Slides are deposited in the Jagiellonian University. When required for identification, morphometry was conducted only under BX53. All relevant structures were measured only if their orientation was suitable, without any deformations.

Morphological primary species hypotheses

We applied the concept of species hypotheses from Pante et al. [19]. After a quick analysis of morphology in light microscopy, all individuals from a given sample were grouped into morphospecies [20], which constituted morphological primary species hypotheses (Fig. 2A). The following papers, containing trustworthy and most updated information, were used for species delineation in light microscopy: 1. Echiniscidae—[21]; 2. Milnesiidae—[22, 23]; 3. Hypsibiidae—[24,25,26,27,28,29,30,31,32]; 4. Ramazzottiidae—[33, 34]; 5. Isohypsibiidae—[24, 25, 35]; 6. Macrobiotidae (not identified to species level when eggs were not found)—[7, 36, 37]; 7. Murrayidae—[38].

Fig. 2
figure 2

The taxonomic approach applied in the present study: A formulation of morphological primary species hypotheses (morPSH) and subsequent DNA barcoding of selected representatives of each morphospecies; B molecular operational taxonomic units (MOTUs) used in phylogenetics and molecular species delimitation methods—as a result, molecular primary species hypotheses (molPSH) were posed; C integration and cross-validation of both PSHs: the most parsimonious and congruent solutions were sought to restrict the number of secondary species hypotheses (SSH), which mostly corresponded with taxa (see Table 2)

Genotyping

Initially, two specimens per each morphospecies from a sample were chosen for DNA barcoding (Fig. 2A); this number was adjusted for populations characterised by atypically wider intraspecific variability (p-distance > 3%, morphological deviations, males in the populations of Milnesium). DNA was extracted from single tardigrades using Chelex® 100 resin [39, 40]. Hologenophores were recovered after the extraction and mounted on permanent slides in Hoyer’s medium when possible, in other cases, paragenophores were preserved [41]. ITS-2 was used as the basic DNA barcode amplified and sequenced in this survey according to the protocols described in [40]; primers used: Echiniscidae (ITS-3: GCATCGATGAAGAACGCAGC, ITS-4: TCCTCCGCTTATTGATATGC; [42], Eutardigrada (ITS2_Eutar_Ff: CGTAACGTGAATTGCAGGAC, ITS2_Eutar_Rr: TGATATGCTTAAGTTCAGCGG; [33], which also contains specific PCR programme used for all amplifications). In some cases, where additionally ITS-1 and COI could aid in species identification, these markers were sequenced, too. Supplementary Material 2 contains primers and original references for specific PCR programmes in both cases. GenBank accession numbers for sequences obtained in this study are presented in Supplementary Material 3.

Molecular primary species hypotheses

A final dataset of molecular operational taxonomic units (MOTUs; [43]) was compiled for each genus (Fig. 2A). In many cases, a quick BLAST search [44] allowed for a confident assignment of MOTUs to taxa, chiefly thanks to the influx of recent integrative redescriptions and revisions. Thus, a morphological identification followed by molecular identification converged into a reliable secondary species hypothesis. However, in several other cases (Milnesium, Macrobiotus, Ramazzottius, and Paramacrobiotus; the first three genera are the most common taxa in Denmark and frequently co-occur in samples, see below), all MOTUs representing a single genus were used in phylogenetic reconstructions for the purpose of molecular species delimitation [45]. All ITS-2 sequences were aligned with a neotype barcode from Echiniscus testudo as outgroup using the ClustalW Multiple Alignment tool [46] implemented and then checked manually in BioEdit ver. 7.2.5 [47]. W-IQ-TREE was used in Maximum Likelihood analyses [48, 49]. Five thousand ultrafast bootstrap (UFBoot) replicates were applied to provide support values for branches [50]. All final consensus trees were visualised by FigTree v.1.4.3 available from https://tree.bio.ed.ac.uk/software/figtree.

Uncorrected pairwise (p) distances were calculated in MEGA version 7.0 with a ‘complete deletion’ option [51]. From all suitable delineation methods [45], we chose one distance-based (ASAP; [52]) and one phylogeny-based (bPTP; [53]), with default settings applied to the datasets. That way, we obtained molecular primary species hypotheses (Fig. 2B).

Data integration and cross-validation

When both molecular and morphological primary species hypotheses were collated, we sought for a maximal congruence between these two sources of evidence. Given that a single universal barcoding gap for all tardigrade lineages is not achievable, at least at present [54], we tended to lump MOTUs more diverging from the remaining MOTUs clearly belonging to the same biological species in cases when both qualitative and quantitative morphology did not indicate any differentiation (see below). This conservative approach might have contributed to a slight underestimation of species richness in Milnesium and Ramazzottius, but prevented over-splitting of still scarce MOTUs into fictitious species (e.g. [55]). In other words, we cross-checked whether molecular primary species hypotheses corresponded with morphospecies, which produced firm secondary species hypotheses (Fig. 2C). The latter can be divided into three groups: (a) named and known taxa; (b) new and unnamed taxa; and (c) taxa, which cannot be reliably identified due to taxonomic obscurities (Table 2).

Table 2 List of Danish cryptogam-dwelling Tardigrada. Asterisk (*) signifies that a species was identified only via morphology (E. testudo has already been cross-validated by molecular data, thus not marked)

Results

Out of 676 examined samples, 171 (25%) were without tardigrades (Supplementary Material 1). The remaining 505 samples (75%) contained tardigrades representing seven families, 21 genera, and 55 species. At least nine spp. (16%) are new to science (Table 2). Heterotardigrades were represented only by a single family Echiniscidae and four widespread spp. of Echiniscus. Apochelan eutardigrades were split into nine Milnesium spp., of which Milnesium sp. nov. 1 apparently is the most common species of the genus in Denmark (63% of all sequenced individuals; Fig. 3A); notable is the presence of two singletons (M. berladnicorum, M. sp. nov. 4), followed by two other rare spp. (M. pseudotardigradum, M. sp. nov. 3). For two dioecious Milnesium spp. (M. dornensis, M. sp. nov. 1), the range of molecular distances was up to 8% because several specimens (< 5% of all sequenced individuals) greatly increased the intraspecific variability (Supplementary Material 4) in ITS-2. This was not accompanied by any easily noticeable morphological differences between studied populations, and was not treated as a sign of interspecific divergence.

Fig. 3
figure 3

Integrated SSH for the genera: A Milnesium; B Macrobiotus, as two examples of conducted analyses. Maximum Likelihood trees were rooted on an outgroup species Echiniscus testudo; scale bars represent substitutions per position. p signifies ranges of uncorrected pairwise distances

Parachelan eutardigrades were classified within five families, of which one—Murrayidae (Paramurrayon meieri)—was present only in one locality. The second rarest family was the Isohypsibiidae, scarcely represented by four spp. As predicted, the most common families were Hypsibiidae (15 spp., including truly ubiquitous Hypsibius dujardini and H. scabropygus), Ramazzottiidae (five spp., with the most common species: Ramazzottius sp. nov. 1 and 2), and Macrobiotidae (17 spp., including seven common Macrobiotus spp.). In contrast to Milnesium, none of the spp. exhibited intraspecific p > 2% (Fig. 3B, Supplementary Material 5), which is lower than usually accepted 3% DNA barcoding threshold in molecular species delineation studies [56].

Discussion

Danish fauna

At first, we compare our results with the historical records (Table 1) and the extensive soil eDNA survey [16], which dealt only with Danish tardigrade fauna. Then, we expand our comparisons to the Norwegian fauna, which has been recently addressed in a great detail using traditional approach based on light microscopy identification [57], aiming at pinpointing taxa not disclosed in Denmark, but probably present in the country.

We found six out of 11 families reported by Pust et al. [16], enriched with the presence of heterotardigrade Echiniscidae, which do not inhabit soil (alternatively, heterotardigrades may require specific primers to be revealed in an eDNA dataset due to large insertions in V4 region of 18S rRNA; [16, 58]). Three out of five families absent in our dataset (eohypsibiids, microhypsibiids, adorybiotids) are generally found sporadically and the first two seem to exhibit preferences towards leaf litter (Bertolanius), soil (Microhypsibius), and even water bodies (Eohypsibius, Microhypsibius) or springs [59, 60]. Hexapodibiids are soil-dwelling [61], and most doryphoribiids (Grevenius, Thulinius) reported by Pust et al. [16] are limnic [62]. Therefore, the absence of all five lineages in our samples was not unexpected.

Echiniscus showed an interesting regionalisation: only E. blumi is widespread in Denmark, whereas E. testudo is present on islands east of Jutland. In contrast, E. merokensis and E. quadrispinosus (Fig. 4) are present only in Jutland. Echiniscus granulatus, typical for mosses from carbonate bedrock [21, 25], was not found (isolated, potentially promising localities on Møn and Bornholm did not yield any record). An unidentified Echiniscus and E. arctomys sp. inq. were reported from Bornholm [63], but these records must remain unverifiable due to the destruction of the European-originating part of the Richters collection (H. Dastych, pers. observation) and may represent an aberrant form of any of the four spp. reported herein (E. merokensis and E. blumi-canadensis complex are known for large morphological variability; [21, 64]) or a Pseudechiniscus species as well. Hallas [65] reported a member of the genus Pseudechiniscus (unlikely to represent P. suillus s.s.) from a suitable habitat on the rocks of Helligdommen (NE Bornholm). However, our resampling of this locality did not unravel the presence of any echiniscid. In general, no other echiniscids were anticipated to be present in Denmark.

Fig. 4
figure 4

An example of biogeographic regionalisation within the Danish fauna: genus Echiniscus. Scale bars in micrometres

The number of Danish Milnesium spp. increased from one (M. tardigradum positively verified) to nine, including five described and further three previously characterised genetically in a large-scale survey [8]. Only M. sp. nov. 4 has not been sequenced previously, which demonstrates that even in relatively well-sampled biogeographic regions, such as the Palaearctic, so far undescribed spp. can be found. Moreover, this increment in known biodiversity plainly corroborates the argumentation of Ugarte & Garraffoni [66], who argued that most historical tardigrade distribution records are not usable for modern taxonomic and ecological research purposes since they can represent multiple, even unrelated spp. Our records, associated with a basic DNA barcode, allow for direct species comparisons and thus can be coupled with future faunistic data for tardigrades more easily.

Among hypsibiids, we confirmed the presence of A. scoticum, H. dujardini, and P. bullatus in Denmark. It is likely that D. alpinum sp. dub. reported by Hallas & Yeates [67] represents in fact D. pingue as the two spp. share a long history of taxonomic confusion [68]. We did not find either Mixibius cf. saracenus, a rare and primarily aquatic species revealed by Pust et al. [16], or D. oculatum, a rare species dwelling mainly in mountains [25]. Ramazzottiids are represented only by Ramazzottius, which instead is among top-three most common genera and embraces at least five distinct spp. Ramazzottius oberhaeuseri and R. kretschmanni, two named spp., are actually much rarer than two undescribed spp. (R. sp. nov. 1 and 2) previously characterised genetically [33]. Among isohypsibiids, we did not find Dianea cf. sattleri reported by Pust et al. [16], and the genus Dianea should be present in Denmark as it is present in the neighbouring Sweden [12] and Germany [69]. All four isohypsibiids are rare and elusive (Table 2).

Macrobiotids are the most speciose family, and the most interesting finding is the disclosure of the presence of Tenuibiotus in Denmark. A single population of Minibiotus from Jutland does not represent M. intermedius (the neotypic COI barcode ON005160 of M. intermedius does not match the Danish population) and its taxonomic status (a new similar species or previously described species lacking DNA barcodes) is uncertain. Both Macrobiotus and Mesobiotus are much commoner than Paramacrobiotus. Macrobiotus hufelandi is confirmed as an element of Danish fauna [65]. In total, nine out of 14 valid spp. reported by Hallas [65] and Hallas & Yeates [67] were positively verified.

As could have been assumed, the Norwegian fauna is more diverse, encompassing almost three times more spp. than Danish fauna [15, 57]. This fact is glaring when e.g. the number of echiniscid taxa is compared (seven genera, 31 spp. vs one genus, four spp.; although it should be noted that Guidetti et al. [57] seem to greatly overestimate the number of Echiniscus spp., probably due to large intraspecific variability interpreted as interspecific disparities). The presence of several recently researched spp. (P. meieri, [38]; Microhypsibius, [57]) or species groups (Macrobiotus persimilis-polonicus complex, [70]) in Denmark, Norway, and Sweden suggests similarity of faunae and biogeographic structuring [9]. With all genera recorded by Pust et al. [16] and by us, a direct comparison can be made with the checklist from [57]. Only one genus, Itaquascon, which is otherwise extremely rare, could be additionally present in Denmark. Apart from it, in our opinion the present contributions revealed a large fraction of cryptogam-inhabiting genera (among aquatic genera not caught by Pust et al. [16], surely at least one Dactylobiotus species is present in Denmark, but its taxonomic affinity is dubious, see Table 1), and a special attention should be given to naming new species in the next step.

Citizen science and faunistics

Reaching the scope of our research would not be possible without an immense effort of pupil and teacher helpers. This is another example of how beneficial the participation of local communities can be in the case of biodiversity research. Similar projects were concluded with a great advancement of knowledge on life history of seahorses [71], monitoring of invasive species [72], conservation biology [73], or species discovery [74]. Given how undersampled vast areas of the globe are in terms of tardigrade diversity, the involvement of citizen sample collectors creates a favourable perspective for efficient formation of taxonomic checklists. Our paper presents the first integrative checklist of tardigrades of an entire country, quadrupling the number of Danish water bears.

Conclusions

Limno-terrestrial, cryptogam-dwelling tardigrade fauna of Denmark is typically Palaearctic, with some cosmopolitan elements (E. testudo, P. fairbanksi). Species α-diversity varies from low to moderate, depending on the family, but it is expected to increase providing that limnic habitats (ponds, lakes, bogs, and rivers) will be sampled. Despite this, a significant fraction of new undescribed spp. warrants next biodiversity surveys and future taxonomic work, preferably drawing from multiple lines of evidence [7, 21, 32, 75].

Availability of data and materials

All data is published in the manuscript and its supplementary materials. Sequences are deposited in GenBank.

References

  1. Hortal J, de Bello F, Diniz-Filho JAF, Lewinsohn TM, Lobo JM, Ladle RJ. Seven shortfalls that beset large-scale knowledge of biodiversity. Annu Rev Ecol Evol Syst. 2015;46:523–49. https://doiorg.publicaciones.saludcastillayleon.es/10.1146/annurev-ecolsys-112414-054400.

    Article  Google Scholar 

  2. Telford MJ, Budd GE, Philippe H. Phylogenomic insights into animal evolution. Curr Biol. 2015;25:876–87. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.cub.2015.07.060.

    Article  CAS  Google Scholar 

  3. Whittaker RJ, Araújo MB, Jepson P, Ladle RJ, Watson JEM, Willis KJ. Conservation biogeography: assessment and prospect. Divers Distrib. 2005;11:3–23. https://doiorg.publicaciones.saludcastillayleon.es/10.1111/j.1366-9516.2005.00143.x.

    Article  Google Scholar 

  4. Garey JR, Krotec M, Nelson DR, Brooks J. Molecular analysis supports a tardigrade-arthropod association. Invertebr Biol. 1996;115:79–88. https://doiorg.publicaciones.saludcastillayleon.es/10.2307/3226943.

    Article  Google Scholar 

  5. Giribet G, Edgecombe GD. Current understanding of Ecdysozoa and its internal phylogenetic relationships. Integr Comp Biol. 2017;57:455–66. https://doiorg.publicaciones.saludcastillayleon.es/10.1093/icb/icx072.

    Article  PubMed  Google Scholar 

  6. Jørgensen A, Kristensen RM, Møbjerg N. Phylogeny and integrative taxonomy of Tardigrada. In: Schill RO, editor. Water bears: The biology of tardigrades. Zoological monographs. Dordrecht: Springer; 2018. p. 95–114. https://doiorg.publicaciones.saludcastillayleon.es/10.1007/978-3-319-95702-9_3

    Chapter  Google Scholar 

  7. Guidetti R, Cesari M, Bertolani R, Altiero T, Rebecchi L. High diversity in species, reproductive modes and distribution within the Paramacrobiotus richtersi complex (Eutardigrada, Macrobiotidae). Zool Lett. 2019;5:1. https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s40851-018-0113-z.

    Article  Google Scholar 

  8. Morek W, Surmacz B, López-López A, Michalczyk Ł. “Everything is not everywhere”: time-calibrated phylogeography of the genus Milnesium (Tardigrada). Mol Ecol. 2021;30:3590–609. https://doiorg.publicaciones.saludcastillayleon.es/10.1111/mec.15951.

    Article  PubMed  PubMed Central  Google Scholar 

  9. Gąsiorek P. Catch me if you can, or how paradigms of tardigrade biogeography evolved from cosmopolitism to ‘localism.’ Zool J Linn Soc. 2023. https://doiorg.publicaciones.saludcastillayleon.es/10.1093/zoolinnean/zlad191.

    Article  Google Scholar 

  10. Riedel A, Sagata K, Suhardjono YR, Tänzler R, Balke M. Integrative taxonomy on the fast track—towards more sustainability in biodiversity research. Front Zool. 2013;10:15. https://doiorg.publicaciones.saludcastillayleon.es/10.1186/1742-9994-10-15.

    Article  PubMed  PubMed Central  Google Scholar 

  11. Delrieu-Trottin E, Williams JT, Pitassy D, Driskell A, Hubert N, Viviani J, Cribb TH, Espiau B, Galzin R, Kulbicki M, Lison de Loma T, Meyer C, Mourier J, Mou-Tham G, Parravicini V, Plantard P, Sasal P, Siu G, Tolou N, Veuille M, Weigt L, Planes S. A DNA barcode reference library of French Polynesian shore fishes. Sci Data. 2019;6:114. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/s41597-019-0123-5.

    Article  PubMed  PubMed Central  Google Scholar 

  12. Guidetti R, Jönsson KI, Kristensen RM. Tardigrades of Sweden; an updated check-list. Zootaxa. 2015;3981:491–507. https://doiorg.publicaciones.saludcastillayleon.es/10.11646/zootaxa.3981.4.2.

    Article  PubMed  Google Scholar 

  13. Thulin G. Beiträge zur Kenntnis der Tardigradenfauna Schwedens. Ark zool. 1911;7:1–60. https://doiorg.publicaciones.saludcastillayleon.es/10.5962/bhl.part.1270.

    Article  Google Scholar 

  14. Thulin G. Über die Phylogenie und das System der Tardigraden. Hereditas. 1928;11:207–66. https://doiorg.publicaciones.saludcastillayleon.es/10.1111/j.1601-5223.1928.tb02488.x.

    Article  Google Scholar 

  15. Meier T. A checklist of Norwegian Tardigrada. Fauna Norv. 2017;37:25–42. https://doiorg.publicaciones.saludcastillayleon.es/10.5324/fn.v37i0.2269.

    Article  Google Scholar 

  16. Pust FL, Frøslev TG, Kristensen RM, Møbjerg N. Environmental DNA metabarcoding of Danish soil samples reveals new insight into the hidden diversity of eutardigrades in Denmark. Zool J Linn Soc. 2024;200:20–33. https://doiorg.publicaciones.saludcastillayleon.es/10.1093/zoolinnean/zlad059.

    Article  Google Scholar 

  17. Degma P. Field and laboratory methods. In: Schill RO, editor. Water bears: the biology of tardigrades. Zoological monographs. Dordrecht: Springer; 2018. p. 349–69. https://doiorg.publicaciones.saludcastillayleon.es/10.1007/978-3-319-95702-9_14.

    Chapter  Google Scholar 

  18. Nelson DR, Bartels PJ, Guil N. Tardigrade ecology. In: Schill RO, editor. Water bears: the biology of tardigrades. Zoological monographs. Dordrecht: Springer; 2018. p. 163–210. https://doiorg.publicaciones.saludcastillayleon.es/10.1007/978-3-319-95702-9_7

    Chapter  Google Scholar 

  19. Pante E, Puillandre N, Viricel A, Arnaud-Haond S, Aurelle D, Castelin M, Chenuil A, Destombe C, Forcioli D, Valero M, Viard F, Samadi S. Species are hypotheses: avoid connectivity assessments based on pillars of sand. Mol Ecol. 2015;24:525–44. https://doiorg.publicaciones.saludcastillayleon.es/10.1111/mec.13048.

    Article  PubMed  Google Scholar 

  20. Derraik JGB, Early JW, Closs GP, Dickinson KJM. Morphospecies and taxonomic species comparison for Hymenoptera. J Insect Sci. 2010;10:108. https://doiorg.publicaciones.saludcastillayleon.es/10.1673/031.010.10801.

    Article  PubMed  PubMed Central  Google Scholar 

  21. Gąsiorek P, Vončina K. Atlas of the Echiniscidae (Heterotardigrada) of the World–part I: West Palaearctic Echiniscus species. Zootaxa. 2023;5344:1–72. https://doiorg.publicaciones.saludcastillayleon.es/10.11646/ZOOTAXA.5344.1.1.

    Article  Google Scholar 

  22. Morek W, Gąsiorek P, Stec D, Blagden B, Michalczyk Ł. Experimental taxonomy exposes ontogenetic variability and elucidates the taxonomic value of claw configuration in Milnesium Doyère, 1840 (Tardigrada: Eutardigrada: Apochela). Contrib Zool. 2016;85:173–200. https://doiorg.publicaciones.saludcastillayleon.es/10.1163/18759866-08502003.

    Article  Google Scholar 

  23. Surmacz B, Morek W, Michalczyk Ł. What if multiple claw configurations are present in a sample? A case study with the description of Milnesium pseudotardigradum sp. nov. (Tardigrada) with unique developmental variability. Zool Stud. 2019;58:32. https://doiorg.publicaciones.saludcastillayleon.es/10.6620/ZS.2019.58-32.

    Article  Google Scholar 

  24. Ramazzotti G, Maucci W. Il Phylum Tardigrada. III edizione riveduta e aggiornata. Mem Ist Ital Idrobiol. 1983;41:1–1011.

    Google Scholar 

  25. Dastych H. The tardigrada of Poland. Monogr Fauny Pol. 1988;16:1–255.

    Google Scholar 

  26. Guidetti R, Bertolani R. The Tardigrades of Emilia (Italy). III. Piane di Mocogno (Northern Apennines). Zool Anz. 2001;240:377–83. https://doiorg.publicaciones.saludcastillayleon.es/10.1078/0044-5231-00045.

    Article  Google Scholar 

  27. Kaczmarek Ł, Michalczyk Ł. Redescription of Hypsibius microps Thulin, 1928 and H. pallidus Thulin, 1911 (Eutardigrada: Hypsibiidae) based on the type material from the Thulin collection. Zootaxa. 2009;2275:60–8. https://doiorg.publicaciones.saludcastillayleon.es/10.11646/zootaxa.2275.1.4.

    Article  Google Scholar 

  28. Gąsiorek P, Stec D, Morek W, Zawierucha K, Kaczmarek Ł, Lachowska-Cierlik D, Michalczyk Ł. An integrative revision of Mesocrista Pilato, 1987 (Tardigrada: Eutardigrada: Hypsibiidae). J Nat Hist. 2016;50:2803–28. https://doiorg.publicaciones.saludcastillayleon.es/10.1080/00222933.2016.1234654.

    Article  Google Scholar 

  29. Gąsiorek P, Stec D, Morek W, Michalczyk Ł. An integrative redescription of Hypsibius dujardini (Doyère, 1840), the nominal taxon for Hypsibioidea (Tardigrada: Eutardigrada). Zootaxa. 2018;4415:45–75. https://doiorg.publicaciones.saludcastillayleon.es/10.11646/zootaxa.4415.1.2.

    Article  PubMed  Google Scholar 

  30. Gąsiorek P, Blagden B, Morek W, Michalczyk Ł. What is a ‘strong’ synapomorphy? Redescriptions of Murray’s type species and descriptions of new taxa challenge the systematics of Hypsibiidae (Eutardigrada: Parachela). Zool J Linn Soc. 2024;202:zlad151. https://doiorg.publicaciones.saludcastillayleon.es/10.1093/zoolinnean/zlad151.

    Article  Google Scholar 

  31. Gąsiorek P, Michalczyk Ł. Phylogeny of Itaquasconinae in light of the evolution of the flexible pharyngeal tube in Tardigrada. Zool Scr. 2020;49:499–515. https://doiorg.publicaciones.saludcastillayleon.es/10.1111/zsc.12424.

    Article  Google Scholar 

  32. Tumanov DV. Integrative redescription of Hypsibius pallidoides Pilato et al., 2011 (Eutardigrada: Hypsibioidea) with the erection of a new genus and discussion on the phylogeny of Hypsibiidae. Eur J Taxon. 2020;681:1–37. https://doiorg.publicaciones.saludcastillayleon.es/10.5852/ejt.2020.681.

    Article  Google Scholar 

  33. Stec D, Morek W, Gąsiorek P, Michalczyk Ł. Unmasking hidden species diversity within the Ramazzottius oberhaeuseri complex, with an integrative redescription of the nominal species for the family Ramazzottiidae (Tardigrada: Eutardigrada: Parachela). Syst Biodivers. 2018;16:357–76. https://doiorg.publicaciones.saludcastillayleon.es/10.1080/14772000.2018.1424267.

    Article  Google Scholar 

  34. Guidetti R, Cesari M, Giovannini I, Ebel C, Förschler MI, Rebecchi L, Schill RO. Morphology and taxonomy of the genus Ramazzottius (Eutardigrada; Ramazzottiidae) with the integrative description of Ramazzottius kretschmanni sp. nov. Eur Zool J. 2022;89:339–63. https://doiorg.publicaciones.saludcastillayleon.es/10.1080/24750263.2022.2043468

    Article  Google Scholar 

  35. Lisi O, Binda MG, Pilato G. Eremobiotus ginevrae sp. nov. and Paramacrobiotus pius sp. nov., two new species of Eutardigrada. Zootaxa. 2016;4103:344–60. https://doiorg.publicaciones.saludcastillayleon.es/10.11646/zootaxa.4103.4.3.

    Article  PubMed  Google Scholar 

  36. Kaczmarek Ł, Michalczyk Ł. The Macrobiotus hufelandi group (Tardigrada) revisited. Zootaxa. 2017;4363:101–23. https://doiorg.publicaciones.saludcastillayleon.es/10.11646/zootaxa.4363.1.4.

    Article  PubMed  Google Scholar 

  37. Tsvetkova AY, Tumanov DV. Tenuibiotus yeliseii sp. nov., a new species of Macrobiotidae (Tardigrada: Eutardigrada) from Svalbard, Norway, with discussion of taxonomic criteria within the genus and its phylogeny. Zoosyst Ross. 2024;33:28–47. https://doiorg.publicaciones.saludcastillayleon.es/10.31610/zsr/2024.33.1.28.

    Article  Google Scholar 

  38. Guidetti R, Giovannini I, Del Papa V, Ekrem T, Nelson DR, Rebecchi L, Cesari M. hylogeny of the asexual lineage Murrayidae (Macrobiotoidea, Eutardigrada) with the description of Paramurrayon gen. nov. and Paramurrayon meieri sp. nov. Invertebr Syst. 2022;36:1099–117. https://doiorg.publicaciones.saludcastillayleon.es/10.1071/IS22031.

    Article  CAS  Google Scholar 

  39. Casquet JT, Thebaud C, Gillespie RG. Chelex without boiling, a rapid and easy technique to obtain stable amplifiable DNA from small amounts of ethanol-stored spiders. Mol Ecol Res. 2012;12:136–41. https://doiorg.publicaciones.saludcastillayleon.es/10.1111/j.1755-0998.2011.03073.x.

    Article  CAS  Google Scholar 

  40. Stec D, Kristensen RM, Michalczyk Ł. An integrative description of Minibiotus ioculator sp. nov. from the Republic of South Africa with notes on Minibiotus pentannulatus Londoño et al., 2017 (Tardigrada: Macrobiotidae). Zool Anz. 2020;286:117–34. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.jcz.2020.03.007.

    Article  Google Scholar 

  41. Pleijel F, Jondelius U, Norlinder E, Nygren A, Oxelman B, Schander C, Sundberg P, Thollesson M. Phylogenies without roots? A plea for the use of vouchers in molecular phylogenetic studies. Mol Phylogen Evol. 2008;48:369–71. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.ympev.2008.03.024.

    Article  CAS  Google Scholar 

  42. White TJ, Bruns T, Lee S, Taylor J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ, editors. PCR protocols: a guide to methods and applications. Orlando: Academic Press; 1990. p. 315–22. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/B978-0-12-372180-8.50042-1.

    Chapter  Google Scholar 

  43. Blaxter M, Mann J, Chapman T, Thomas F, Whitton C, Floyd R, Abebe E. Defining operational taxonomic units using DNA barcode data. Phil Trans R Soc B: Biol Sci. 2005;360:1935–43. https://doiorg.publicaciones.saludcastillayleon.es/10.1098/rstb.2005.1725.

    Article  CAS  Google Scholar 

  44. Camacho C, Coulouris G, Avagyan V, Ma N, Papadopoulos J, Bealer K, Madden TL. BLAST+: architecture and applications. BMC Bioinform. 2009;10:421. https://doiorg.publicaciones.saludcastillayleon.es/10.1186/1471-2105-10-421.

    Article  CAS  Google Scholar 

  45. Luo A, Ling C, Ho SYW, Zhu C-D. Comparison of methods for molecular species delimitation across a range of speciation scenarios. Syst Biol. 2018;67:830–46. https://doiorg.publicaciones.saludcastillayleon.es/10.1093/sysbio/syy011.

    Article  PubMed  PubMed Central  Google Scholar 

  46. Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994;22:4673–80.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  47. Hall TA. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser. 1999;41:95–8.

    CAS  Google Scholar 

  48. Nguyen L-T, Schmidt HA, von Haeseler A, Minh BQ. IQ-TREE: a fast and effective stochastic algorithm for estimating maximum likelihood phylogenies. Mol Biol Evol. 2015;32:268–74. https://doiorg.publicaciones.saludcastillayleon.es/10.1093/molbev/msu300.

    Article  PubMed  CAS  Google Scholar 

  49. Trifinopoulos J, Nguyen L-T, von Haeseler A, Minh BQ. W-IQ-TREE: a fast online phylogenetic tool for maximum likelihood analysis. Nucleic Acids Res. 2016;44:232–5. https://doiorg.publicaciones.saludcastillayleon.es/10.1093/nar/gkw256.

    Article  CAS  Google Scholar 

  50. Hoang DT, Chernomor O, von Haeseler A, Minh BQ, Vinh LS. UFBoot2: Improving the ultrafast bootstrap approximation. Mol Biol Evol. 2018;35:518–22. https://doiorg.publicaciones.saludcastillayleon.es/10.1093/molbev/msx281.

    Article  PubMed  CAS  Google Scholar 

  51. Kumar S, Stecher G, Tamura K. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol Biol Evol. 2016;33:1870–4. https://doiorg.publicaciones.saludcastillayleon.es/10.1093/molbev/msw054.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  52. Puillandre N, Brouillet S, Achaz G. ASAP: assemble species by automatic partitioning. Mol Ecol Res. 2021;21:609–20. https://doiorg.publicaciones.saludcastillayleon.es/10.1111/1755-0998.13281.

    Article  Google Scholar 

  53. Zhang J, Kapli P, Pavlidis P, Stamatakis A. A general species delimitation method with applications to phylogenetic placements. Bioinformatics. 2013;29:2869–76. https://doiorg.publicaciones.saludcastillayleon.es/10.1093/bioinformatics/btt499.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  54. Cesari M, Vincenzi J, Giovannini I, Rebecchi L, Guidetti R. Is there a universal DNA barcode gap in tardigrades? In: Michalczyk Ł, editor. 15th International Symposium on Tardigrada. Symposium Book; Jagiellonian Unievrsity: Kraków, 2022, p. 155.

  55. Zhang H-G, Lv M-H, Yi W-B, Zhu W-B, Bu W-J. Species diversity can be overestimated by a fixed empirical threshold: insights from DNA barcoding of the genus Cletus (Hemiptera: Coreidae) and the meta-analysis of COI data from previous phylogeographical studies. Mol Ecol Res. 2017;17:314–23. https://doiorg.publicaciones.saludcastillayleon.es/10.1111/1755-0998.12571.

    Article  CAS  Google Scholar 

  56. Hebert PDN, Cywinska A, Ball SL, deWaard JR. Biological identifications through DNA barcodes. Proc R Soc B: Biol Sci. 2003;270:313–21. https://doiorg.publicaciones.saludcastillayleon.es/10.1098/rspb.2002.2218.

    Article  CAS  Google Scholar 

  57. Guidetti R, Jönsson KI, Kaczmarek Ł, Meier T, Speed JDM, Prestø T, Stur E, Topstad L, Cesari M, Roszkowska M, Zawierucha K, Hassel K, Ekrem T. Tardigrade diversity and community composition across Norwegian boreal forests. Zool J Linn Soc. 2024;200:156–71. https://doiorg.publicaciones.saludcastillayleon.es/10.1093/zoolinnean/zlad136.

    Article  Google Scholar 

  58. Jørgensen A, Faurby S, Hansen JG, Møbjerg N, Kristensen RM. Molecular phylogeny of Arthrotardigrada (Tardigrada). Mol Phylogen Evol. 2010;54:1006–15. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.ympev.2009.10.006.

    Article  Google Scholar 

  59. Kristensen RM. New aberrant eutardigrades from homothermic springs on Disko Island, West Greenland. In: Nelson DR, editor. Proceedings of the third international symposium on the Tardigrada, 1980. East Tennessee State University Press: Johnson City, USA, 1982, p. 203–220.

  60. Bertolani R, Kristensen RM. New records of Eohypsibius nadjae Kristensen, 1982, and revision of the taxonomic position of two genera of Eutardigrada (Tardigrada). In: Bertolani R, editor. Biology of tardigrades. Mucchi: Modena Selected Symposia and Monographs U.Z.I.; 1987. p. 359–72.

    Google Scholar 

  61. Cesari M, Vecchi M, Palmer A, Bertolani R, Pilato G, Rebecchi L, Guidetti R. What if the claws are reduced? Morphological and molecular phylogenetic relationships of the genus Haplomacrobiotus May, 1948 (Eutardigrada, Parachela). Zool J Linn Soc. 2016;178:819–27. https://doiorg.publicaciones.saludcastillayleon.es/10.1111/zoj.12424.

    Article  Google Scholar 

  62. Gąsiorek P, Stec D, Morek W, Michalczyk Ł. Deceptive conservatism of claws: distinct phyletic lineages concealed within Isohypsibioidea (Eutardigrada) revealed by molecular and morphological evidence. Contrib Zool. 2019;88:78–132. https://doiorg.publicaciones.saludcastillayleon.es/10.1163/18759866-20191350.

    Article  Google Scholar 

  63. Richters F. Beitrag zur Verbreitung der Tardigraden im südlichen Skandinavien und an der mecklenburgischen Küste. Zool Anz. 1904;28:347–52.

    Google Scholar 

  64. Guil N, Giribet G. Fine scale population structure in the Echiniscus blumi-canadensis series (Heterotardigrada, Tardigrada) in an Iberian mountain range—When morphology fails to explain genetic structure. Mol Phylogen Evol. 2009;51:606–13. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.ympev.2009.02.019.

    Article  CAS  Google Scholar 

  65. Hallas TE. Danmarks tardigrader. Nat Mus. 1969;13:3–18.

    Google Scholar 

  66. Ugarte PDS, Garraffoni ARS. Removal of historical taxonomic bias and its impact on biogeographic analyses: a case study of Neotropical tardigrade fauna. Zool J Linn Soc. 2024;201:zlae091. https://doiorg.publicaciones.saludcastillayleon.es/10.1093/zoolinnean/zlae091.

    Article  Google Scholar 

  67. Hallas TE, Yeates GW. Tardigrada of the soil and litter of a Danish beech forest. Pedobiologia. 1972;12:287–304. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/S0031-4056(23)02046-2.

    Article  Google Scholar 

  68. Pilato G, Binda MG. A comparison of Diphascon (D.) alpinum Murray, 1906, D. (D.) chilenense Plate, 1889 and D. (D.) pingue Marcus, 1936 (Tardigrada), and description of a new species. Zool Anz. 1997;236:181–5.

    Google Scholar 

  69. Dastych H. Isohypsibius sattleri (Richters, 1902), a valid species (Tardigrada). Senck biol. 1990;71:181–9.

    Google Scholar 

  70. Massa E, Guidetti R, Cesari M, Rebecchi L, Jönsson KI. Tardigrades of Kristianstads Vattenrike biosphere reserve with description of four new species from Sweden. Sci Rep. 2021;11:4861. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/s41598-021-83627-w.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  71. Camins E, Stanton LM, Correia M, Foster SJ, Koldewey HJ, Vincent ACJ. Advances in life-history knowledge for 35 seahorse species from community science. J Fish Biol. 2024;104:1548–65. https://doiorg.publicaciones.saludcastillayleon.es/10.1111/jfb.15699.

    Article  PubMed  Google Scholar 

  72. Sheard JK, Sanders NJ, Gundlach C, Schär S, Larsen RS. Monitoring the influx of new species through citizen science: the first introduced ant in Denmark. PeerJ. 2020;8: e8850. https://doiorg.publicaciones.saludcastillayleon.es/10.7717/peerj.8850.

    Article  PubMed  PubMed Central  Google Scholar 

  73. Tulloch AIT, Possingham HP, Joseph LN, Szabo J, Martin TG. Realising the full potential of citizen science monitoring programs. Biol Conserv. 2013;165:128–38. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.biocon.2013.05.025.

    Article  Google Scholar 

  74. Hartop EA, Brown BV, Disney RHL. Opportunity in our ignorance: Urban biodiversity study reveals 30 new species and one new Nearctic record for Megaselia (Diptera: Phoridae) in Los Angeles (California, USA). Zootaxa. 2015;3941:451–84. https://doiorg.publicaciones.saludcastillayleon.es/10.11646/zootaxa.3941.4.1.

    Article  PubMed  Google Scholar 

  75. Cesari M, Bertolani R, Rebecchi L, Guidetti R. DNA barcoding in Tardigrada: the first case study on Macrobiotus macrocalix Bertolani & Rebecchi 1993 (Eutardigrada, Macrobiotidae). Mol Ecol Res. 2009;9:699–706. https://doiorg.publicaciones.saludcastillayleon.es/10.1111/j.1755-0998.2009.02538.x.

    Article  CAS  Google Scholar 

  76. Kristensen RM, Hallas TE. The tidal genus Echiniscoides and its variability, with erection of Echiniscoididae fam. n. (Tardigrada). Zool Scr. 1980;9:113–1276. https://doiorg.publicaciones.saludcastillayleon.es/10.1111/j.1463-6409.1980.tb00657.x

    Article  Google Scholar 

  77. Jørgensen A, Kristensen RM. Molecular phylogeny of Tardigrada—investigation of the monophyly of Heterotardigrada. Mol Phylogen Evol. 2004;32:666–70. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.ympev.2004.04.017.

    Article  CAS  Google Scholar 

  78. Møbjerg N, Jørgensen A, Eibye-Jacobsen J, Halberg KA, Persson D, Kristensen RM. New records on cyclomorphosis in the marine eutardigrade Halobiotus crispae (Eutardigrada: Hypsibiidae). J Limnol. 2007;66:132–40. https://doiorg.publicaciones.saludcastillayleon.es/10.4081/jlimnol.2007.s1.132.

    Article  Google Scholar 

  79. Hallas TE. Notes on the marine Hypsibius stenostomus-complex, with a description of a new species (Tardigrada, Macrobiotidae). Steenstrupia. 1971;1:201–6.

    Google Scholar 

  80. Jørgensen A, Møbjerg N, Kristensen RM. A molecular study of the tardigrade Echiniscus testudo (Echiniscidae) reveals low DNA sequence diversity over a large geographical area. J Limnol. 2007;66:77–83. https://doiorg.publicaciones.saludcastillayleon.es/10.4081/jlimnol.2007.s1.77.

    Article  Google Scholar 

  81. Jørgensen A, Faurby S, Persson DK, Halberg KA, Kristensen RM, Møbjerg N. Genetic diversity in the parthenogenetic reproducing tardigrade Echiniscus testudo (Heterotardigrada: Echiniscoidea). J Limnol. 2013;72:136–43. https://doiorg.publicaciones.saludcastillayleon.es/10.4081/jlimnol.2013.s1.e17.

    Article  Google Scholar 

  82. Morek W, Stec D, Gąsiorek P, Surmacz B, Michalczyk Ł. Milnesium tardigradum Doyère, 1840: the first integrative study of interpopulation variability in a tardigrade species. J Zool Syst Evol Res. 2019;57:1–23. https://doiorg.publicaciones.saludcastillayleon.es/10.1111/jzs.12233.

    Article  Google Scholar 

  83. Tumanov DV, Androsova ED, Avdeeva GS, Leontev AA. First faunistic investigation of semiterrestrial tardigrade fauna of North-West Russia using the method of DNA barcoding. Invertebr Zool. 2022;19:452–74. https://doiorg.publicaciones.saludcastillayleon.es/10.15298/invertzool.19.4.08.

    Article  Google Scholar 

  84. Erdmann W, Kosicki JZ, Kayastha P, Mioduchowska M, Kaczmarek Ł. An integrative description of Mesobiotus mandalori sp. nov. (Eutardigrada, Macrobiotoidea) from Poland. Eur Zool J. 2024;91:378–94.

    Article  Google Scholar 

  85. Kayastha P, Szydło W, Mioduchowska M, Kaczmarek Ł. Morphological and genetic variability in cosmopolitan tardigrade species—Paramacrobiotus fairbanksi Schill, Förster, Dandekar & Wolf, 2010. Sci Rep. 2023;13:17672. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/s41598-023-42653-6.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

Download references

Acknowledgements

Various participants (schools, pupils, teachers, and Astra) of the Masseeksperiment ‘23 are acknowledged for their contribution to this project. Two reviewers helped in improving this manuscript.

Funding

Open access funding provided by Copenhagen University. The research was funded by the Villum fonden, Nordea-fonden, 15. Juni Fonden, Friluftsrådet, and Aage V. Jensen Naturfond.

Author information

Authors and Affiliations

Authors

Contributions

PG collected and analysed data, wrote the first draft of the manuscript, and prepared figures; MVS co-analysed data; MRL & FL coordinated the process of field sampling and data acquisition; APT provided funding. All authors participated in writing and agreed on the final version of the manuscript.

Corresponding author

Correspondence to Piotr Gąsiorek.

Ethics declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

12983_2024_547_MOESM1_ESM.xlsx

Supplementary Material 1: S1. Collection data. Quantity means the total approximate number of all tardigrades found in a sample. The list of tardigrade records per sample is given in the form of three-letter abbreviations formed ad hoc from the first three letters of the generic and specific name, e.g. ‘Ech.tes’ signifies Echiniscus testudo. Each record is followed by an approximate number of specimens, categorised into these groups: 1, <10 (2–9), <50 (10–49), <100 (50–99), ≥100, extracted from a single Petri dish (PD).

12983_2024_547_MOESM2_ESM.docx

Supplementary Material 2: S2. Primers and PCR programmes for ITS-1 and COI markers, sequenced additionally in this study.

Supplementary Material 3: S3. GenBank accession numbers.

Supplementary Material 4: S4. Matrices of intraspecific p-distances for Milnesium.

Supplementary Material 5: S5. Matrices of intraspecific p-distances for Macrobiotus.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Gąsiorek, P., Sørensen, M.V., Lillemark, M.R. et al. Massive citizen science sampling and integrated taxonomic approach unravel Danish cryptogam-dwelling tardigrade fauna. Front Zool 21, 27 (2024). https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12983-024-00547-x

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12983-024-00547-x

Keywords